Review



surface stem cell marker tra1 60  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Miltenyi Biotec surface stem cell marker tra1 60
    Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% <t>SSEA4/TRA1-60,</t> G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)
    Surface Stem Cell Marker Tra1 60, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tra1+60+antibody/TRA-1-60+Antibody%2C+anti-human%2C+REAfinity/pmc13352860-130-13-20
    Average 95 stars, based on 42 article reviews
    surface stem cell marker tra1 60 - by Bioz Stars, 2026-09
    95/100 stars

    Images

    1) Product Images from "Activation of the G-protein coupled estrogen receptor 1 (GPER1) reduces transient receptor potential vanilloid 1 (TRPV1) activity and human iPSC-derived nociceptive neuron firing"

    Article Title: Activation of the G-protein coupled estrogen receptor 1 (GPER1) reduces transient receptor potential vanilloid 1 (TRPV1) activity and human iPSC-derived nociceptive neuron firing

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-026-05174-3

    Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% SSEA4/TRA1-60, G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)
    Figure Legend Snippet: Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% SSEA4/TRA1-60, G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)

    Techniques Used: Virus, Derivative Assay, Staining, Generated, Flow Cytometry, Control, Expressing

    Related Articles

    Knock-Out:

    Article Title: Generation of an NCS1 gene knockout human induced pluripotent stem cell line using CRISPR/Cas9.
    Article Snippet: .. Antibody Dilution Company Cat # and RRID Markers for undifferentiated iPSCs SSEA-4 Antibody, anti-human, PerCpVio700, REAfinityTM 1:10 Miltenyi Biotec, 130-105-053 SSEA-4 Antibody, anti-human, VioBlue, REAfinityTM 1:20 Miltenyi Biotec, 130-098-366 Oct3/4 Antibody, anti-human/mouse, APC, REAfinityTM 1:10/ 1:100 Miltenyi Biotec, 130-123-257 Tra1-60 Antibody, anti-human, Vio488, REAfinityTM 1:100/ 1:700 Miltenyi Biotec, 130-106-872 Nanog (D73G4) XP Rabbit mAb (PE Conjugate) 1:100 Cell Signaling, 14955 Primary antibodies knockout-confirmation in immunofluorescence and western blot Mouse anti-NCS1 1:1000 Santa Cruz, Cat #sc-376206, RRID: AB_11008074 Rabbit anti-GAPDH 1:500 Merck, Cat#ABS16, RRID: AB_10806772 Secondary antibodies Alexa Fluor Donkey anti-mouse 680 1:15,000 Thermo Fisher Scientific Cat# A-32788, RRID: AB_2762831) Alexa Fluor Donkey anti-rabbit 800 1:15,000 Thermo Fisher Scientific, Cat# A- 32808, RRID: AB_2762837 Nuclear stain Hoechst33342 1 μg/mL InvitrogenTM, Cat# H3570 Site-specific nuclease CRISPR-Cas9 Alt-R® S.p. .. HiFi Cas9 Nuclease V3, 500 μg Integrated DNA technologies, 1,081,061 Nucleofection 1200 V, 30 ms, 1 pulse Neon/Invitrogen-TFS No selection Single cell cloning using IsoCell IotaSciences Primers and Oligonucleotides used in this study Target Forward/Reverse primer (5′-3′) e.g. Episomal Plasmids (qPCR or RT-PCR) NA e.g. Pluripotency Markers (qPCR) NA e.g. House-Keeping Genes (qPCR) NA Genotyping (desired allele/transgene presence detection) PCR specific for the targeted allele Targeted mutation analysis/sequencing PCR specific for the targeted location followed by Sanger sequencing Primer design: https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Primers to amplify 500–600 bp having mutation in middle of product: NCS1-Fw1: ATGTCAGTTCGTAACCCCCT NCS1-Rev1: TGCATGTCAGTATGCACTCGT NCS1-Fw2: GCTCACTCTGTGTGCAGTATC NCS1-Rev2: CTAGAAGGGAACATCGGCAGG Potential random integration-detecting PCRs Not relavant as we did not use any plasmids gRNA oligonucleotide/crRNA sequence gRNA1:CUUGAUGAAGCCUUUGUACC gRNA2:UCUGCUGCCUCCAGGUACAA Genomic target sequence(s) NCS1, Exon3 GRCh38 Chr9:130217834 and 130,217,835 Bioinformatic gRNA on- and -off-target binding prediction tool used, specific sequence/outputs link(s) Synthego gRNA design https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = UCUGCUGCCUCCAGGUACAA https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = CUUGAUGAAGCCUUUGUACC Primers for top off-target mutagenesis predicted site sequencing OT1 - RELN OT2 - UBR3 OT3 – PDZD2 OT4 - TRPM6 OT5 - TENM3 OT6 - CDH18 F: CCACTAGACGCTTCTCTTCTTC/ R: GCATCTAAGAGAGGGTTGGATT F: TGGTGGCCCATAACTGTAATC/ R: ACCCTTGAATTGCTTGACACTA F: CTGGAAATGGACCACAAAGGA/ R: GGTTAAGATGAGGATGGAGGAAAG F: TCACAACAAACGTTAGACGTAGAT/ R: CTGCCTCTTGTGCCGAATTA F: CTATTGAAGTGCCACCATATTGC/ R: CAGTGTTTGTTGGCATGGTATC F: GGCAGACCTTCAACCATCA/ R: GCCTTAAATGAGAGAATGAGAGAATG ODNs/plasmids/RNA molecules used as templates for HDRmediated site-directed mutagenesis.

    Immunofluorescence:

    Article Title: Generation of an NCS1 gene knockout human induced pluripotent stem cell line using CRISPR/Cas9.
    Article Snippet: .. Antibody Dilution Company Cat # and RRID Markers for undifferentiated iPSCs SSEA-4 Antibody, anti-human, PerCpVio700, REAfinityTM 1:10 Miltenyi Biotec, 130-105-053 SSEA-4 Antibody, anti-human, VioBlue, REAfinityTM 1:20 Miltenyi Biotec, 130-098-366 Oct3/4 Antibody, anti-human/mouse, APC, REAfinityTM 1:10/ 1:100 Miltenyi Biotec, 130-123-257 Tra1-60 Antibody, anti-human, Vio488, REAfinityTM 1:100/ 1:700 Miltenyi Biotec, 130-106-872 Nanog (D73G4) XP Rabbit mAb (PE Conjugate) 1:100 Cell Signaling, 14955 Primary antibodies knockout-confirmation in immunofluorescence and western blot Mouse anti-NCS1 1:1000 Santa Cruz, Cat #sc-376206, RRID: AB_11008074 Rabbit anti-GAPDH 1:500 Merck, Cat#ABS16, RRID: AB_10806772 Secondary antibodies Alexa Fluor Donkey anti-mouse 680 1:15,000 Thermo Fisher Scientific Cat# A-32788, RRID: AB_2762831) Alexa Fluor Donkey anti-rabbit 800 1:15,000 Thermo Fisher Scientific, Cat# A- 32808, RRID: AB_2762837 Nuclear stain Hoechst33342 1 μg/mL InvitrogenTM, Cat# H3570 Site-specific nuclease CRISPR-Cas9 Alt-R® S.p. .. HiFi Cas9 Nuclease V3, 500 μg Integrated DNA technologies, 1,081,061 Nucleofection 1200 V, 30 ms, 1 pulse Neon/Invitrogen-TFS No selection Single cell cloning using IsoCell IotaSciences Primers and Oligonucleotides used in this study Target Forward/Reverse primer (5′-3′) e.g. Episomal Plasmids (qPCR or RT-PCR) NA e.g. Pluripotency Markers (qPCR) NA e.g. House-Keeping Genes (qPCR) NA Genotyping (desired allele/transgene presence detection) PCR specific for the targeted allele Targeted mutation analysis/sequencing PCR specific for the targeted location followed by Sanger sequencing Primer design: https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Primers to amplify 500–600 bp having mutation in middle of product: NCS1-Fw1: ATGTCAGTTCGTAACCCCCT NCS1-Rev1: TGCATGTCAGTATGCACTCGT NCS1-Fw2: GCTCACTCTGTGTGCAGTATC NCS1-Rev2: CTAGAAGGGAACATCGGCAGG Potential random integration-detecting PCRs Not relavant as we did not use any plasmids gRNA oligonucleotide/crRNA sequence gRNA1:CUUGAUGAAGCCUUUGUACC gRNA2:UCUGCUGCCUCCAGGUACAA Genomic target sequence(s) NCS1, Exon3 GRCh38 Chr9:130217834 and 130,217,835 Bioinformatic gRNA on- and -off-target binding prediction tool used, specific sequence/outputs link(s) Synthego gRNA design https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = UCUGCUGCCUCCAGGUACAA https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = CUUGAUGAAGCCUUUGUACC Primers for top off-target mutagenesis predicted site sequencing OT1 - RELN OT2 - UBR3 OT3 – PDZD2 OT4 - TRPM6 OT5 - TENM3 OT6 - CDH18 F: CCACTAGACGCTTCTCTTCTTC/ R: GCATCTAAGAGAGGGTTGGATT F: TGGTGGCCCATAACTGTAATC/ R: ACCCTTGAATTGCTTGACACTA F: CTGGAAATGGACCACAAAGGA/ R: GGTTAAGATGAGGATGGAGGAAAG F: TCACAACAAACGTTAGACGTAGAT/ R: CTGCCTCTTGTGCCGAATTA F: CTATTGAAGTGCCACCATATTGC/ R: CAGTGTTTGTTGGCATGGTATC F: GGCAGACCTTCAACCATCA/ R: GCCTTAAATGAGAGAATGAGAGAATG ODNs/plasmids/RNA molecules used as templates for HDRmediated site-directed mutagenesis.

    Western Blot:

    Article Title: Generation of an NCS1 gene knockout human induced pluripotent stem cell line using CRISPR/Cas9.
    Article Snippet: .. Antibody Dilution Company Cat # and RRID Markers for undifferentiated iPSCs SSEA-4 Antibody, anti-human, PerCpVio700, REAfinityTM 1:10 Miltenyi Biotec, 130-105-053 SSEA-4 Antibody, anti-human, VioBlue, REAfinityTM 1:20 Miltenyi Biotec, 130-098-366 Oct3/4 Antibody, anti-human/mouse, APC, REAfinityTM 1:10/ 1:100 Miltenyi Biotec, 130-123-257 Tra1-60 Antibody, anti-human, Vio488, REAfinityTM 1:100/ 1:700 Miltenyi Biotec, 130-106-872 Nanog (D73G4) XP Rabbit mAb (PE Conjugate) 1:100 Cell Signaling, 14955 Primary antibodies knockout-confirmation in immunofluorescence and western blot Mouse anti-NCS1 1:1000 Santa Cruz, Cat #sc-376206, RRID: AB_11008074 Rabbit anti-GAPDH 1:500 Merck, Cat#ABS16, RRID: AB_10806772 Secondary antibodies Alexa Fluor Donkey anti-mouse 680 1:15,000 Thermo Fisher Scientific Cat# A-32788, RRID: AB_2762831) Alexa Fluor Donkey anti-rabbit 800 1:15,000 Thermo Fisher Scientific, Cat# A- 32808, RRID: AB_2762837 Nuclear stain Hoechst33342 1 μg/mL InvitrogenTM, Cat# H3570 Site-specific nuclease CRISPR-Cas9 Alt-R® S.p. .. HiFi Cas9 Nuclease V3, 500 μg Integrated DNA technologies, 1,081,061 Nucleofection 1200 V, 30 ms, 1 pulse Neon/Invitrogen-TFS No selection Single cell cloning using IsoCell IotaSciences Primers and Oligonucleotides used in this study Target Forward/Reverse primer (5′-3′) e.g. Episomal Plasmids (qPCR or RT-PCR) NA e.g. Pluripotency Markers (qPCR) NA e.g. House-Keeping Genes (qPCR) NA Genotyping (desired allele/transgene presence detection) PCR specific for the targeted allele Targeted mutation analysis/sequencing PCR specific for the targeted location followed by Sanger sequencing Primer design: https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Primers to amplify 500–600 bp having mutation in middle of product: NCS1-Fw1: ATGTCAGTTCGTAACCCCCT NCS1-Rev1: TGCATGTCAGTATGCACTCGT NCS1-Fw2: GCTCACTCTGTGTGCAGTATC NCS1-Rev2: CTAGAAGGGAACATCGGCAGG Potential random integration-detecting PCRs Not relavant as we did not use any plasmids gRNA oligonucleotide/crRNA sequence gRNA1:CUUGAUGAAGCCUUUGUACC gRNA2:UCUGCUGCCUCCAGGUACAA Genomic target sequence(s) NCS1, Exon3 GRCh38 Chr9:130217834 and 130,217,835 Bioinformatic gRNA on- and -off-target binding prediction tool used, specific sequence/outputs link(s) Synthego gRNA design https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = UCUGCUGCCUCCAGGUACAA https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = CUUGAUGAAGCCUUUGUACC Primers for top off-target mutagenesis predicted site sequencing OT1 - RELN OT2 - UBR3 OT3 – PDZD2 OT4 - TRPM6 OT5 - TENM3 OT6 - CDH18 F: CCACTAGACGCTTCTCTTCTTC/ R: GCATCTAAGAGAGGGTTGGATT F: TGGTGGCCCATAACTGTAATC/ R: ACCCTTGAATTGCTTGACACTA F: CTGGAAATGGACCACAAAGGA/ R: GGTTAAGATGAGGATGGAGGAAAG F: TCACAACAAACGTTAGACGTAGAT/ R: CTGCCTCTTGTGCCGAATTA F: CTATTGAAGTGCCACCATATTGC/ R: CAGTGTTTGTTGGCATGGTATC F: GGCAGACCTTCAACCATCA/ R: GCCTTAAATGAGAGAATGAGAGAATG ODNs/plasmids/RNA molecules used as templates for HDRmediated site-directed mutagenesis.

    Staining:

    Article Title: Generation of an NCS1 gene knockout human induced pluripotent stem cell line using CRISPR/Cas9.
    Article Snippet: .. Antibody Dilution Company Cat # and RRID Markers for undifferentiated iPSCs SSEA-4 Antibody, anti-human, PerCpVio700, REAfinityTM 1:10 Miltenyi Biotec, 130-105-053 SSEA-4 Antibody, anti-human, VioBlue, REAfinityTM 1:20 Miltenyi Biotec, 130-098-366 Oct3/4 Antibody, anti-human/mouse, APC, REAfinityTM 1:10/ 1:100 Miltenyi Biotec, 130-123-257 Tra1-60 Antibody, anti-human, Vio488, REAfinityTM 1:100/ 1:700 Miltenyi Biotec, 130-106-872 Nanog (D73G4) XP Rabbit mAb (PE Conjugate) 1:100 Cell Signaling, 14955 Primary antibodies knockout-confirmation in immunofluorescence and western blot Mouse anti-NCS1 1:1000 Santa Cruz, Cat #sc-376206, RRID: AB_11008074 Rabbit anti-GAPDH 1:500 Merck, Cat#ABS16, RRID: AB_10806772 Secondary antibodies Alexa Fluor Donkey anti-mouse 680 1:15,000 Thermo Fisher Scientific Cat# A-32788, RRID: AB_2762831) Alexa Fluor Donkey anti-rabbit 800 1:15,000 Thermo Fisher Scientific, Cat# A- 32808, RRID: AB_2762837 Nuclear stain Hoechst33342 1 μg/mL InvitrogenTM, Cat# H3570 Site-specific nuclease CRISPR-Cas9 Alt-R® S.p. .. HiFi Cas9 Nuclease V3, 500 μg Integrated DNA technologies, 1,081,061 Nucleofection 1200 V, 30 ms, 1 pulse Neon/Invitrogen-TFS No selection Single cell cloning using IsoCell IotaSciences Primers and Oligonucleotides used in this study Target Forward/Reverse primer (5′-3′) e.g. Episomal Plasmids (qPCR or RT-PCR) NA e.g. Pluripotency Markers (qPCR) NA e.g. House-Keeping Genes (qPCR) NA Genotyping (desired allele/transgene presence detection) PCR specific for the targeted allele Targeted mutation analysis/sequencing PCR specific for the targeted location followed by Sanger sequencing Primer design: https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Primers to amplify 500–600 bp having mutation in middle of product: NCS1-Fw1: ATGTCAGTTCGTAACCCCCT NCS1-Rev1: TGCATGTCAGTATGCACTCGT NCS1-Fw2: GCTCACTCTGTGTGCAGTATC NCS1-Rev2: CTAGAAGGGAACATCGGCAGG Potential random integration-detecting PCRs Not relavant as we did not use any plasmids gRNA oligonucleotide/crRNA sequence gRNA1:CUUGAUGAAGCCUUUGUACC gRNA2:UCUGCUGCCUCCAGGUACAA Genomic target sequence(s) NCS1, Exon3 GRCh38 Chr9:130217834 and 130,217,835 Bioinformatic gRNA on- and -off-target binding prediction tool used, specific sequence/outputs link(s) Synthego gRNA design https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = UCUGCUGCCUCCAGGUACAA https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = CUUGAUGAAGCCUUUGUACC Primers for top off-target mutagenesis predicted site sequencing OT1 - RELN OT2 - UBR3 OT3 – PDZD2 OT4 - TRPM6 OT5 - TENM3 OT6 - CDH18 F: CCACTAGACGCTTCTCTTCTTC/ R: GCATCTAAGAGAGGGTTGGATT F: TGGTGGCCCATAACTGTAATC/ R: ACCCTTGAATTGCTTGACACTA F: CTGGAAATGGACCACAAAGGA/ R: GGTTAAGATGAGGATGGAGGAAAG F: TCACAACAAACGTTAGACGTAGAT/ R: CTGCCTCTTGTGCCGAATTA F: CTATTGAAGTGCCACCATATTGC/ R: CAGTGTTTGTTGGCATGGTATC F: GGCAGACCTTCAACCATCA/ R: GCCTTAAATGAGAGAATGAGAGAATG ODNs/plasmids/RNA molecules used as templates for HDRmediated site-directed mutagenesis.

    CRISPR:

    Article Title: Generation of an NCS1 gene knockout human induced pluripotent stem cell line using CRISPR/Cas9.
    Article Snippet: .. Antibody Dilution Company Cat # and RRID Markers for undifferentiated iPSCs SSEA-4 Antibody, anti-human, PerCpVio700, REAfinityTM 1:10 Miltenyi Biotec, 130-105-053 SSEA-4 Antibody, anti-human, VioBlue, REAfinityTM 1:20 Miltenyi Biotec, 130-098-366 Oct3/4 Antibody, anti-human/mouse, APC, REAfinityTM 1:10/ 1:100 Miltenyi Biotec, 130-123-257 Tra1-60 Antibody, anti-human, Vio488, REAfinityTM 1:100/ 1:700 Miltenyi Biotec, 130-106-872 Nanog (D73G4) XP Rabbit mAb (PE Conjugate) 1:100 Cell Signaling, 14955 Primary antibodies knockout-confirmation in immunofluorescence and western blot Mouse anti-NCS1 1:1000 Santa Cruz, Cat #sc-376206, RRID: AB_11008074 Rabbit anti-GAPDH 1:500 Merck, Cat#ABS16, RRID: AB_10806772 Secondary antibodies Alexa Fluor Donkey anti-mouse 680 1:15,000 Thermo Fisher Scientific Cat# A-32788, RRID: AB_2762831) Alexa Fluor Donkey anti-rabbit 800 1:15,000 Thermo Fisher Scientific, Cat# A- 32808, RRID: AB_2762837 Nuclear stain Hoechst33342 1 μg/mL InvitrogenTM, Cat# H3570 Site-specific nuclease CRISPR-Cas9 Alt-R® S.p. .. HiFi Cas9 Nuclease V3, 500 μg Integrated DNA technologies, 1,081,061 Nucleofection 1200 V, 30 ms, 1 pulse Neon/Invitrogen-TFS No selection Single cell cloning using IsoCell IotaSciences Primers and Oligonucleotides used in this study Target Forward/Reverse primer (5′-3′) e.g. Episomal Plasmids (qPCR or RT-PCR) NA e.g. Pluripotency Markers (qPCR) NA e.g. House-Keeping Genes (qPCR) NA Genotyping (desired allele/transgene presence detection) PCR specific for the targeted allele Targeted mutation analysis/sequencing PCR specific for the targeted location followed by Sanger sequencing Primer design: https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Primers to amplify 500–600 bp having mutation in middle of product: NCS1-Fw1: ATGTCAGTTCGTAACCCCCT NCS1-Rev1: TGCATGTCAGTATGCACTCGT NCS1-Fw2: GCTCACTCTGTGTGCAGTATC NCS1-Rev2: CTAGAAGGGAACATCGGCAGG Potential random integration-detecting PCRs Not relavant as we did not use any plasmids gRNA oligonucleotide/crRNA sequence gRNA1:CUUGAUGAAGCCUUUGUACC gRNA2:UCUGCUGCCUCCAGGUACAA Genomic target sequence(s) NCS1, Exon3 GRCh38 Chr9:130217834 and 130,217,835 Bioinformatic gRNA on- and -off-target binding prediction tool used, specific sequence/outputs link(s) Synthego gRNA design https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = UCUGCUGCCUCCAGGUACAA https://design.synthego.com/#/validate/results? genome = homo_sapiens_gencode_26_primary&nuclease = cas9&guide = CUUGAUGAAGCCUUUGUACC Primers for top off-target mutagenesis predicted site sequencing OT1 - RELN OT2 - UBR3 OT3 – PDZD2 OT4 - TRPM6 OT5 - TENM3 OT6 - CDH18 F: CCACTAGACGCTTCTCTTCTTC/ R: GCATCTAAGAGAGGGTTGGATT F: TGGTGGCCCATAACTGTAATC/ R: ACCCTTGAATTGCTTGACACTA F: CTGGAAATGGACCACAAAGGA/ R: GGTTAAGATGAGGATGGAGGAAAG F: TCACAACAAACGTTAGACGTAGAT/ R: CTGCCTCTTGTGCCGAATTA F: CTATTGAAGTGCCACCATATTGC/ R: CAGTGTTTGTTGGCATGGTATC F: GGCAGACCTTCAACCATCA/ R: GCCTTAAATGAGAGAATGAGAGAATG ODNs/plasmids/RNA molecules used as templates for HDRmediated site-directed mutagenesis.



    Similar Products

    surface stem cell marker tra1 60  (Miltenyi Biotec)
    95
    Miltenyi Biotec surface stem cell marker tra1 60
    Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% <t>SSEA4/TRA1-60,</t> G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)
    Surface Stem Cell Marker Tra1 60, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tra1+60+antibody/TRA-1-60+Antibody%2C+anti-human%2C+REAfinity/pmc13352860-130-13-20
    Average 95 stars, based on 1 article reviews
    surface stem cell marker tra1 60 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    tra1 60  (Santa Cruz Biotechnology)
    94
    Santa Cruz Biotechnology tra1 60
    Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% <t>SSEA4/TRA1-60,</t> G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)
    Tra1 60, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tra1+60+antibody/TRA-1-60+Antibody/pmc12868028-132-15-22
    Average 94 stars, based on 1 article reviews
    tra1 60 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    anti tra1 60 sc 21705 santa cruz biotechnology  (Santa Cruz Biotechnology)
    94
    Santa Cruz Biotechnology anti tra1 60 sc 21705 santa cruz biotechnology
    Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% <t>SSEA4/TRA1-60,</t> G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)
    Anti Tra1 60 Sc 21705 Santa Cruz Biotechnology, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tra1+60+antibody/TRA-1-60+Antibody/bio_rxiv__2025__09__25__678439-227-25-27
    Average 94 stars, based on 1 article reviews
    anti tra1 60 sc 21705 santa cruz biotechnology - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    mouse against tra1 60  (Santa Cruz Biotechnology)
    94
    Santa Cruz Biotechnology mouse against tra1 60
    Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% <t>SSEA4/TRA1-60,</t> G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)
    Mouse Against Tra1 60, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tra1+60+antibody/TRA-1-60+Antibody/pmc12714143-609-29-34
    Average 94 stars, based on 1 article reviews
    mouse against tra1 60 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    33707 podocalyxin tra1 60  (Santa Cruz Biotechnology)
    93
    Santa Cruz Biotechnology 33707 podocalyxin tra1 60
    Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% <t>SSEA4/TRA1-60,</t> G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)
    33707 Podocalyxin Tra1 60, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tra1+60+antibody/Perlecan+Antibody/pmc12276242__42003_2025_8484_MOESM1_ESM-154-212-208
    Average 93 stars, based on 1 article reviews
    33707 podocalyxin tra1 60 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% SSEA4/TRA1-60, G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)

    Journal: Stem Cell Research & Therapy

    Article Title: Activation of the G-protein coupled estrogen receptor 1 (GPER1) reduces transient receptor potential vanilloid 1 (TRPV1) activity and human iPSC-derived nociceptive neuron firing

    doi: 10.1186/s13287-026-05174-3

    Figure Lengend Snippet: Reprogramming of adult human dermal fibroblasts (HDFa) into induced pluripotent stem cell (iPSC) line BO-VC1. Reprogramming was performed using the Epi5 ™ Episomal iPSC Reprogramming Kit, enabling the generation of ( A ) transgene- and virus-free iPSC line BO-VC1. Successful generation of fibroblast-derived iPSCs was validated by immunocytochemical staining for the pluripotency markers ( B ) SOX2, C TRA 1–60, D OCT4, SSEA4 and E NANOG. Quantification of the generated iPSCs via flow cytometry revealed F 99.31% SSEA4/TRA1-60, G 97.43% SOX2/TRA1-60 and H 98.60% OCT3/4/TRA1-60 positive cells. I Quantification of the transcript levels of the stem cell markers NANOG , OCT4 , REX1 and SOX2 revealed significantly higher mRNA levels in iPSC line BO-VC1 compared to the HDFa control ( n = 3 different passages) Moreover, generated iPSCs were functionally validated by directed differentiation into all three germ layers. Subsequent immunocytochemical staining of the iPSCs before and after differentiation confirmed the expression of ( J–M ) meso-, N–Q endo- and R–U ectodermal lineage markers only in the respective differentiations. Scale bars: 50 μm. Data were tested for normal distribution using Shapiro-Wilk test. Means ± SEM (standard error of the mean) were statistically analyzed by a Kruskal-Wallis test with Dunn’s multiple comparisons test. n = 3 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001)

    Article Snippet: After harvesting, using Accutase, 1 × 10 6 cells were stained for the surface stem cell marker TRA1-60 (1:50, #130-122-965, Miltenyi Biotec, Bergisch Gladbach, Germany) and SSEA4 (1:50, #130-124-073, Miltenyi Biotec, Bergisch Gladbach, Germany) in 25 μl PEB buffer (PBS + 0.5% BSA) for 10 min at 4 °C, washed in 500 μl PEB buffer and centrifuged at 200xg for 5 min.

    Techniques: Virus, Derivative Assay, Staining, Generated, Flow Cytometry, Control, Expressing